In the Wuhan antibody prevalence study, trained nurses or physicians wearing appropriate personal protective equipment collected nasal swabs, throat swabs, sputum, anal swabs, or bronchoalveolar lavage from patients with COVID-19; only throat swabs were collected from healthcare providers without confirmed COVID-19. A nucleic acid detection kit was used according to the manufacturer’s protocol to amplify and detect the SARS-CoV-2 ORF1ab and nucleocapsid (N) genes. ORF1ab used forward primer CCCTGTGGGTTTTACACTTAA, reverse primer ACGATTGTGCATCAGCTGA, and probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. N used forward primer GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG, and probe 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Amplification consisted of 15 minutes at 50 °C and 5 minutes at 95 °C, followed by 40 cycles of 15 seconds at 94 °C and 45 seconds at 55 °C. Under the stated diagnostic criteria, a cycle-threshold value below 37 was positive, a value of at least 40 was negative, and values from 37 through 39 required retesting.