Activity (Process)

RT-PCR Protocol for SARS-CoV-2 RNA in the Wuhan Antibody Prevalence Study

In the Wuhan antibody prevalence study, trained nurses or physicians wearing appropriate personal protective equipment collected nasal swabs, throat swabs, sputum, anal swabs, or bronchoalveolar lavage from patients with COVID-19; only throat swabs were collected from healthcare providers without confirmed COVID-19. A nucleic acid detection kit was used according to the manufacturer’s protocol to amplify and detect the SARS-CoV-2 ORF1ab and nucleocapsid (N) genes. ORF1ab used forward primer CCCTGTGGGTTTTACACTTAA, reverse primer ACGATTGTGCATCAGCTGA, and probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. N used forward primer GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG, and probe 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Amplification consisted of 15 minutes at 50 °C and 5 minutes at 95 °C, followed by 40 cycles of 15 seconds at 94 °C and 45 seconds at 55 °C. Under the stated diagnostic criteria, a cycle-threshold value below 37 was positive, a value of at least 40 was negative, and values from 37 through 39 required retesting.

0

1

Updated 2026-08-30

Tags

SARS-CoV-2 (COVID-19)

Biomedical Sciences